مقاله رایگان با موضوع نرم افزار، روشهای ارزیابی

دانلود پایان نامه

به عنوان تعداد سلولهای زنده موجود در محیط کشت گزارش میشود.

۳-۶-۱- روش فلوسایتومتری۴۳
از جمله روش‌های اندازه‌گیری انواع واکنش‌پذیر اکسیژن، فلوسایتومتری میباشد. فلوسایتومتری تکنولوژی است که به طور همزمان چندین ویژگی فیزیکی ذرات (عموما سلولها) را اندازه گیری و سپس آنالیز مینماید. خصوصیات قابل اندازهگیری شامل اندازه نسبی ذرات، مجزا بودن یا پیچیدگی ذاتی و شدت نسبی فلورسنس آنها میباشد. این ویژگیها با کاربرد یک سیستم نوری-الکترونیکی تعیین میشوند که گزارش میکند چگونه سلول نور لیزر را جذب و فلورسنس از خود ساطع میکند. یک فلوسایتومتر از سه سیستم اصلی مایع، نور و الکترونیک تشکیل شده است.
سیستم مایع، ذرات را به سمت پرتوی لیزر جهت بررسی انتقال میدهد.
• سیستم نوری، حاوی لیزرهایی برای درخشان ساختن ذرات موجود در نمونه میباشد و فیلترهای نوری سیگنالهای نور ایجاد شده را به سمت آشکارسازهای۴۴ مناسب هدایت میکند.
• سیستم الکترونیک، سیگنالهای نوری شناسایی شده را به سیگنالهای الکترونی تبدیل میکند که توسط کامپیوتر پردازش میگردد.
در این تکنیک ذرات یا سلولهایی با اندازه ۱۵۰-۲/۰ میکرومتر برای آنالیز مناسب میباشند. در صورت استفاده از بافت، سلولهای موجود در آن ابتدا باید تفکیک گردند و سپس مورد بررسی قرار گیرند(Shapiro, 2005).
در این روش از پروب‌های فلوئورسنت نظیر ۲ و ۷ – دی‌کلروفلئورسین دی‌استات۴۵(DCFH-DA) استفاده می‌شود. مزیت این روش این است که اولا میزان ROS داخل سلولی را در تک تک سلول‌ها می‌سنجد، ثانیا بین سلول‌ها و جمعیت‌های غیرسلولی تفکیک قائل می‌شود، همچنین قابلیت اندازه‌گیری ROS را در جمعیت‌های زیاد اسپرمی دارد. به علاوه مراحل آماده‌سازی و اندازه گیری به سرعت قابل انجام است(Lampiao et al., 2006). DCFH-DA با حل شدن در غشاء لیپیدی به داخل سلول نفوذ می‌کند. در داخل سلول، گروه استات آن توسط آنزیم استراز۴۶ جدا و به دی‌کلروفلئورسین (DCFH)، تبدیل می‌شود. DCFH قابلیت خروج از سلول را ندارد و هنگامیکه توسط انواع ROS، اکسایش می‌یابد به رنگ سبز فلوئورسنتِ DCF تبدیل می‌شود(Lampiao et al., 2006).(شکل ۳- ۲).

پروب دیگری که در این روش استفاده می شود، دی هیدرو اتیدیوم (DHE) است که توسط آنیون سوپراکسید داخل سلولی به اتیدیوم برماید تبدیل میشود. در داخل سلول این ترکیب به DNA متصل شده و رنگ فلورسنت قرمز را منتشر مینماید. DCFH-DA و DHE به ترتیب، پروب اختصاصی جهت شناسایی H2O2 و O2-• میباشند( Mahfouz, R. et al., 2010).
۳-۶-۲- سنجش ROS در بیضه بوسیله فلوسایتومتری
سلولهای بافت بیضه جهت سنجش ROS مورد استفاده قرار گرفتند. میزان ROSدر این سلولها پس از کشتن حیوان و تک سلولی کردن سلولهای بیضه سنجیده شد. برای سنجش ROS توسط فلوسایتومتری، از رنگهای DCFH-DA و DHE استفاده شد که به ترتیب اختصاصی جهت اندازه گیری H2O2 و °¯ O2میباشند. این رنگها قادر به عبور از غشای سلول بوده و در مـواجه با ROS درون سلولی اکسیـد میشوند. DCFH-DA پس از اکسید شدن با H2O2 به (۴۷DCF) تبدیل میشود و DHE توسط °¯O2 به۴۸HE ، یکی از مشتقات اتیدیوم بروماید، اکسید میشود. اکسایش این ترکیبات توسط عوامل اکساینده و انواع واکنشپذیر اکسیژن، سبب ایجاد یک ترکیب فلورسنت در محدوده نور سبز و قرمز می‌شود (طول موج رنگ سبز بین ۵۰۰ و ۵۳۰ نانومتر و رنگ قرمز بین ۵۹۰ و ۷۰۰ نانومتر میباشد). رنگ‌آمیزی سلول‌ها به شرح زیر انجام شد:
۱- رنگ DCFH-DA با غلظت ۱۰میلیمولار درDMSO بدون آب و رنگ DHE با غلظت ۲۵/۱ میکرومولار در اتانل ساخته شد.
۲- یک میکرولیتر از رنگ DCFH-DA در ۹۹۹ میکرولیتر PBS حل شد و ۱۰-۱۵ ثانیه ورتکس شد.
۳- رنگ بالا به همراه ۲۵/۱ میکرولیتر رنگ DHE به حدود یک میلیون سلول اضافه شد و سلول‌ها در ۳۷ درجه سانتیگراد به مدت ۱۵ دقیقه انکوبه شدند.
۴- سلول‌ها سه بار با PBS شستشو شدند و میزان رادیکالهای آزاد با دستگاه فلوسایتومتری خوانده شد(Mahfouz, Sharma, Lackner, Aziz, & Agarwal, 2009).
۳-۷- روشهای تعیین آسیب DNA اسپرم
سلامت ژنتیکی اسپرم برای لقاح و تکامل جنین ضروری است. مطالعات بسیاری، آسیب DNA در اسپرم را بررسی و ارتباط آن را با ناباروری مردان گزارش نمودهاند.
آسیب DNA اسپرم را میتوان به طور مستقیم (فراگمنتاسیون) و یا به طور غیر مستقیم (تراکم کروماتین اسپرم) مورد ارزیابی قرار داد. آسیب DNA اسپرم را میتوان به طور مستقیم توسط تکنیکهای ۴۹COMET50, TUNEL و یا SCD51 که در آنها فراگمنتاسیون DNA اندازهگیری میشود، بررسی نمود.
آسیب DNA اسپرم را همچنین میتوان به طور غیر مستقیم به وسیله آزمونهای بررسی تراکم۵۲ کروماتین اسپرم و یا با ارزیابی سطوح پروتئینهای هستهای بررسی نمود. در آزمونهای بررسی تراکم کروماتین اسپرم، پروتئینهای هستهای مورد رنگآمیزی قرار میگیرندTamburrino et al., 2011.

شکل (۳-۳) روشهای ارزیابی شکست DNA و نحوه تشخیص آنها. روش SCSA قابل تشخیص با دستگاه فلوسایتومتری .روشهای SCS,AOT,COMET,ISNT قابل تشخیص با میکروسکوپ فلورسنت در روش TUNEL هم از میکروسکوپ فلورسنت و دستگاه فلوسایتومتری میتوان استفاده کرد(Tamburrino et al., 2012).
جهت تشخیص آسیب DNAبا توجه به نوع تست، میتوان از میکروسکوپ فلورسنت۵۳ یا دستگاه فلوسایتومتری۵۴ استفاده کرد(Agarwal & Said, 2004).
۳-۷-۱- تست TUNEL جهت ارزیابی شکست DNAاسپرم
این آزمون اولین بار توسط Gorczica و همکاران در سال ۱۹۹۳ انجام گرفت وبرای تشخیص میزان آسیب در دورشتهی DNAکاربرد دارد. در این روش شکستها در یک یا دو رشته DNA قابل تشخیص است. پایانههای DNAفراگمنته شده، تک رشته و دو رشتهDNA توسط نوکلئوتیدهای نشاندار شده، و مورد هدف قرار میگیرند(Agarwal & Said, 2004). این واکنش توسط یک پایانه ترانسفرازی کاتالیز میشود. این آنزیم، دیاکسییوریدین تغییر یافته را با بیوتین یا دیگوکسیژنین(digoxigenin) درپایانه ۳´OHاز رشتهای که شکسته شده است، ترکیب میکند. سپس نوکلئوتیدهای تغییر یافته که متصل به فلورسنت میباشد نمایان میگردند. نوکلئوتید به طور مستقیم با فلئوکروم نشاندار میشود. رنگ فلورسنت مشاهده شده در هر اسپرم، نشانگر افزایش تعداد شکستگیهایDNA است. درصد اسپرمهای رنگ گرفته بیانگر میزان آسیب DNA اسپرم است. برای تشخیص اسپرمهای آسیب دیده میتوان از دو روش مشاهده با میکروسکوپ فلورسنت یا دستگاه فلوسایتومتری استفاده کرد.

این مطلب مشابه را هم بخوانید :   دانلود تحقیق با موضوع اجرای احکام، اجرای احکام مدنی، قانون مدنی، صاحب نظران

شکل (۳-۴): اساس روش TUNEL(Sharma, Masaki, & Agarwal, 2013)

۳-۷-۲- جمع‌آوری سلول‌های اسپرمی جهت آنالیز شکستهای DNA اسپرم
ناحیه انتهایی اپیدیدیم جدا شده و پس از ایجاد چندین برش عرضی در آن، به مدت۲۰-۱۵دقیقه در یک میلی لیتر محیطTCM ،%۱۰ (جدول ۳-۱) حاوی ۱۰ درصد FBS55 درون انکوباتور C̊۳۷ در حضور ۵% CO2 و ۹۰% رطوبت قرار گرفت(Krause, 1995).
بعد از گذشت ۴۵ دقیقه، کل محلول رویی را کشیده و ۷ دقیقه، ۱۲۰۰rpm سانتریفوژ کرده و به رسوب HTF56، ۱۰% (جدول ۳-۲)افزوده و تا زمان تست DFI در تانک ازت نگهداری شد.

جدول (۳-۱): ترکیب محیط TCM
۱۰۰ میلی لیتر
TCM
۰۳۳/۰ گرم
پیروات
۰۱/۰ گرم
استرادیول
۶./۰ میلیگرم
پنی سیلین جی
۰۵/۰ میلیگرم
استرپتومایسین
۹۸/۰گرم
مدیوم ۱۹۹
۲۲/۰میلیگرم
سدیم بی کربنات
تا حجم ۱۰۰ میلی لیتر
آب

جدول (۳-۲): ترکیب محیط HTF
۱۰۰ میلی لیتر
HTF
۵۹/۰ گرم
کلرید سدیم
۰۳۵/۰ گرم
کلرید پتاسیم
۰۵./۰ گرم
پتاسیمدی هیدروژن فسفات
۰۰۲/۰ گرم
سولفات منیزیم
۰۰۳/۰ گرم
پیروات
۰۵/۰ گرم
دی- گلوکز
۰۰۵/۰ گرم
استرپتومایسین
۰۰۱/۰ گرم
فنل رد
۲۴/۰ گرم
HEPES
۰۰۲/۰ گرم
EDTA
تا حجم ۱۰۰ میلی لیتر
آب

۳-۷-۳- محلولها و بافرهای مورد نیاز جهت روش TUNEL، به منظور ارزیابی شکست DNA اسپرم
۱- بافر شستشو: PBS
۲- محلول تثبیت کننده: پارافرمالدهید ۴ درصد در PBS (pH=7/4,Fresh)
۳- محلول نفوذپذیرسازی: ۱/۰ درصد تریتونX100 در ۱/۰ درصد سدیمسیترات(Fresh)
۴- محلول۵۷ PI 1درصد برای رنگآمیزی اسپرمهای سالم از نظر DNA
۵- ترکیب واکنش کننده TUNEL: اضافه کردن ۴۵۰ میکرولیتر از ویال محلول نوکلئوتید نشاندار به ویال محلول آنزیمی ۵۰ میکرولیتری
۳-۷-۴- مراحل انجام آزمایش TUNEL
۱- تهیه اسمیر روی لامها و خشک کردن آنها در دمای اتاق
۲- فیکس کردن لامها با محلول تثبیت کننده به مدت ۱ ساعت در دمای اتاق
۳- شستشو با PBS
۴- پیپت کردن محلول نفوذپذیرسازی روی اسمیر و قرار دادن لامها به مدت ۱۰ دقیقه در دمای ۸-۲ درجه سانتیگراد
۵- شستشوی لامها در PBS(دوبار) و خشک کردن اطراف اسمیر
۶- اضافه کردن ۵۰ میکرولیتر از ترکیب واکنش کننده فعال به هر لام در تاریکی و انکوباسیون لام ها در انکوباتور ۳۷ درجه
۷- شستشو لامها در PBS (سه بار)
۸- اضافه کردن رنگ PI
۹- مشاهده زیر میکروسکوپ فلورسانس و شمارش حداقل ۱۰۰ اسپرم و درصدگیری (اسپرمهای سبز رنگ نشاندهنده آسیب DNA میباشد).
۳-۷-۵- نحوه استفاده از کیت TUNEL
کیت TUNEL از شرکت Roche آلمان خریداری شده است. هر کیت قابلیت انجام ۵۰ تست را داراست. دمای نگهداری کیت ۱۵ تا ۲۵ درجه سانتیگراد بوده و حساس به نور است. بنابراین باید در تاریکی نگهداری شود. کیت از ۱۰ ویال که ۵ عدد آن حاوی محلول نشانگر با درپوش بنفش رنگ و ۵ عدد باقیمانده حاوی آنزیم TDT58 با درپوش آبی میباشد، تشکیل شده است. محلول آنزیمی، وظیفه شناسایی شکستگیهای موجود در دو رشته DNA، از طریق انتهای آزاد ۳´OH را بر عهده دارد. محلول نشانگر، یک نشانگر فلورسنت پلیمرهای نوکلئوتیدی است که به وسیله میکروسکوپ فلورسنت تشخیص داده میشود.
۳-۸- بررسی بیان ژن Kdm5d یا Smcy
ابتدا با روش RT-PCR و سپس با روش Real-Time PCR بیان ژن مورد مطالعه، ارزیابی شد. نام ژن مورد نظر و توالی پرایمر مورد استفاده در جدول۳-۳ آمده است که با استفاده از نرم افزار Perl Primer طراحی شد و برای اطمینان از پرایمر مربوطه توسط نرم افزار Gene Runner هم چک شد.

جدول (۳-۳): ژن مورد نظر و توالی پرایمر مورد استفاده(که توسط نگارنده طراحی شده است)
نام ژن مورد نظر
(۵’ ۳’) توالی پرایمر
Gapdh
FOR: 5´GACTTCAACAGCAACTCCCAC 3´
REV: 5´TCCACCACCCTGTTGCTGTA 3´
Kdm5d
FOR: 5´ACT TGT CAC TCT GAT GAA TCC T 3´
REV: 5´TCC AAC AGG TAG CCA ATC G 3´

۳-۸-۱- استخراج RNA به روش ترایزول
استخراج RNA در سه مرحله، زیر هود شیمیایی و روی یخ انجام شد. برای جلوگیری از آلودگی با DNA و احتمال از دست رفتن RNA، از ویالهای DNase-RNase free و سرسمپلرهای فیلتردار استفاده

دیدگاهتان را بنویسید